Name and Surname: Amal Khudair Khalaf

Nationality: Iraq

Corresponding Address: Dept. of Microbiology - College of Medicine -University of Thi-Qar.

Organization: University of Thi-Qar

Mobile: 07802521845

Language: Arabic , English.

Education certificates:

- Professor of parasitology since 2019-2020

- Assistant professor of parasitology from 2015 to 2019

- Lecturer of parasitology from 2012 to 2015

- PhD. \Biology \ Parasitology \ University of Basrah /Iraq 2012

- M.Sc.\Biology\ Parasitology \ University of Basrah /Iraq 2008

- B.Sc. \Biology \ University of Basrah \ Iraq \ 2001

• Parasitology
• Microbiology
• Nanotechnology
• Molecular Biology
• Pharmacology and Pharmaceutical
• Secondary Metabolites and Natural Products

• Use TVK 3/7 gene as a target to detect Trichomonas vaginalis from urine of women in Southern Iraq
• Use PCR technique to detect Trichomonas vaginalis among men in Basrah province
• In vitro activity of alkaloids extracted from Chlorophyta and Cyanophyta against the hydatid disease compared with albendazole
• Antiprotoscolices activity of Nonadecoic acid ; Phthalic acid, diflorophenyl undecyl ster and 1,2- Benzendicarboxylic acid , bis (2- ethylhexyl )ester extracted from Cladophora crispata and Hapalosihon aureus compared with albendazole
• Effects of Hydatid cyst infection on some biochemical and haematological parameters in experimental mice Balb\c strain
• Detection of Trichomonas vaginalis among women with abnormal vaginal discharge by PCR technique targeting the sequence TVK3 ( 5' ATTGTCGAACATTGGTCTTACCCTC 3' ) and for TVK7 (5' TCTGTGCCGTCTTCAAGTATGC 3' ) in Basrah province .
• Zinc toxicity associated with hydatid cyst infection among patients in Nasseriyah city \ Thiqar province , south Iraq Detection of some trace elements in hydatid cyst fluid of –
• Experimentally infected albino mice (Balb\C strain) by atomic .absorption spectroscopy
• In vitro activity of (2- deca - 3,d- dienyloxy) carbonyl benzeoic acid extracted from Cladophora crispata against the protoscolices of hydatid cyst compared with albendazole activity.
• Cardiac hydatidosis : A rare infection of the heart with hydatid cyst of Echinococcus granulosus can produced anaemia .
• Study the association between the infection with Trichomonas vaginalis and use of contraceptive among women with abnormal vaginal discharge by PCR technique in Nassiriyah city .
• Antiparasitic activity of the microalgae Cladophora crispata against the Protoscolices of hydatid cysts compared with alben- dazole drug
• Evaluation of pathological change of hydatid cyst on kidney of experimentally infected mice.
• In vitro Antiparasitic activity of Triazolo[1,5-a] pyrimidine carboxylic acid extracted from cyanophyton Hapalosiphon welweschii against Trichomonas vaginalis.
• Antiparasitic activity of microalgae Hapalosipohon aurius extract against the protoscolices of hydatid cyst compared albendazole drug.
• In vitro and In vivo activity of (2- deca - 3,d- dienyloxy) carbonyl benzeoic acid extracted from Cladophora crispata against the spleenic hydatid cyst.
• In vitro Antiparasitic activity of Triazolo[1,5-a] pyrimidine carboxylic acid extracted from cyanophyton Hapalosiphon welweschii against Trichomonas vaginalis.
• Detection of trace elements in the hydatid cyst fluid removed from patients with hydatidosis in Nassirriyah city by atomic absorption spectroscopy .
• Use PCR technique to detect the infection with Trichomonas vaginalis among women with preterm labor.
• In vitro and In vivo activity of (2- deca - 3,d- dienyloxy) carbonyl benzoic acid extracted from microalgae Hapalosiphon welweschii against the hydatid cyst . .
• Levels of trace elements in hydatid cyst fluid : Analytical study -
• Epidemiological , hematological and histopathological study for cutaneous leishmaniasis in Nassirriyah city \ Thiqar- Province
• Study the prevalence and histopathological changes of cutaneous leishmaniasis in Nassirriyah city \ Thiqar- Province .
• In vitro activity of Triazolo[1,5-a] pyrimidine carboxylic acid extracted from microalgae Hapalosiphon welweschii against the protoscolices of hydatid cyst
• Efficacy and safety of Curcuma longa essential oil to inactivate hydatid cyst protoscoleces.
• Prevalence and associated risk factors of intestinal helminthic infections in children from Lorestan province, Western Iran.
• Testing the activity of Alkaloids extracted from Clorella volgaris on the viability of Trichomonas vaginalis In vitro.
• In Vitro and Ex Vivo Evaluation of Capparis Spinosa Extract to Inactivate Protoscoleces During Hydatid cyst Surgery.
• Therapeutic Potential of Green Synthesized Copper Nanoparticles Alone or Combined with Meglumine Antimoniate (Glucantime®) in Cutaneous Leishmaniasis.
• The Potential Use of Nitazoxanide in the Treatment of Cutaneous Leishmaniasis: In-Vitro Assays Against Leishmania Tropica.
• Morphological characterization of Moniliformis moniliformis isolated from an Iraqi patient.
• Copper nanoparticles: Biosynthesis, characterization, and protoscolicidal effects alone and combined with albendazole against hydatid cyst protoscoleces.
• Fe3O4@piroctone olamine magnetic nanoparticles: Synthesize and therapeutic potential in cutaneous leishmaniasis.
• Chitosan-Based Nanomaterials as Valuable Sources of AntiLeishmanial Agents: A Systematic Review
• Antileishmanial, cellular mechanisms, and cytotoxic effects of green synthesized zinc nanoparticles alone and in combined with glucantime against Leishmania major infection.
• Immune-enhancing activity of Astragalus maximus extract for inhibiting the Toxoplasma gondii infection: experimental research
• Antiparasitic Effects and Cellular Mechanisms of Formononetin (a Natural Isoflavone) Against Hydatid Cyst Protoscoleces
• Promising effects of formononetin, a natural isoflavone derived from herbs, against Toxoplasma gondii
• Serological Detection for Toxoplasmosis among Patients with Covid-19 in Thi-Qar Province
• Sero-prevalence of Toxoplasma gondii among Diabetic patients in Thi-Qar province/ South of Iraq.
• Estimation the Level of Interferon Gamma for Diabetic Patients Infected with Toxoplasmosis in Thi-Qar Province / Southern Iraq.
• Serological detection for Entamoeba histolytica among cancer patients suffering from diarrhea in Thi-Qar province/ Southern Iraq.
• Antiparasitic activity of Astragalus brachycalyx subsp. brachycalyx extract against hydatid cyst protoscoleces and its effect on induction of apoptosis: an in vitro and ex vivo study.
• MOLECULAR DIVERSITY FOR ENTAMOEBA HISTOLYTICA VIRULENCE FACTOR GENES ISOLATED FROM PATIENTS WITH AMOEBIC DYSENTERY.
• High prevalence of Cryptosporidium infection in Iranian patients suffering from colorectal cancer.
• Effects of green synthesized zinc nanoparticles alone and along with albendazole against hydatid cyst protoscoleces.
• CHEMICAL STUDY FOR HYDATID CYST OF LUNG ISOLATED FROM PATIENT WITH HYDATIDOSIS.
• Chemical composition, antileishmanial, and cytotoxic effects Ferula macrecolea essential oil against Leishmania tropica.
• Biochemical study for Amoebic dysentery in patients with Entamoeba histolytica in Thi-Qar province/southern Iraq.
• Antiparasitic Effects and Cellular Mechanism of Astragalus maximus Chloroform Extract Against Clinical Isolates of Giardia lamblia.
• Detection of Cryptosporidium Parvum among Cancer Patients by Serological Method in Thi-Qar Province / Southern Iraq.
• Immunological study for some parasitic infection among patients with cancer in Thi-Qar province.
• Toxoplasma Gondii Related Programmed Cell Death (Pd1 and Pd-L1) in Patients with Diabetes Mellitus.
• Molecular Study for the Virulence Factor of Entamoeba spp by Gene Sequence Technique.
• The effect of infection with Toxoplasma gondii in inducing interferon-gamma in breast cancer patients.
• Prevalence, socioeconomic, and associated risk factors of oral cavity parasites in children with intellectual disability from lorestan province , iran .
• Detection of other microbial infections among COVId -19 patient in thi-qar province/ southern Iraq.

No content available to display!!!

No content available to display!!!